Journal: STAR protocols

Article Title: Specific and efficient gene knockout and overexpression in mouse interscapular brown adipocytes in vivo.

doi: 10.1016/j.xpro.2022.101895

Figure Lengend Snippet: Figure 5. Set up injection device (A) 33G needle for pen injectors. (B) Connect the tail end of a pen needle to a polyethylene tubing. (C) The injection device assembled by connecting a needle of microsyringe (50 mL) to the other side of the polyethylene tubing.

Article Snippet: ATCGTCGTCGTCGTCATCCT This paper N/A sgRNA-resis-mutation-F: GGGGAGGAGAGGTGGAGACGTG TATACGGTTCCCTCCAGCTCAGG This paper N/A sgRNA-resis-mutation-R: CTGAGACCTGAGCTGGAGGGAACC GTATACACGTCTCCACCTCTC This paper N/A Recombinant DNA lentiCRISPRv2 Addgene Cat. #52961 pAAV-U6-gRNA-CBh-mCherry Addgene Cat. #91947 pAAV-ADP-MCS-FLAG Addgene Cat. #192360 pRC2/8 Addgene Cat. #112864 pHelper Addgene Cat. #112867 Software and algorithms CRISPOR TEFOR Infrastructure Version 5.01 ICE Synthego Version 3.0 Other Surgical swabs N/A N/A Animal hair clipper N/A N/A Heating pad N/A N/A Surgical scissors Fine Science Tools Cat. #14002-12 Curved forceps Fine Science Tools Cat. #11052-10 Surgical suture clips Fine Science Tools Cat. #12022-09 Clip applicator Fine Science Tools Cat. #12018-12 Microsyringe (50 mL) Hamilton Cat. #80500 Polyethylene tubing Smiths Medical Cat. #10793527 Nanopass33 (33G needle for pen injectors) Terumo Corp. N/A ll OPEN ACCESS Protocol

Techniques: Injection